90
|
ARTEC CO LTD
3d digitizer 3d Digitizer, supplied by ARTEC CO LTD, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/3d+data+processing+software+gom+inspect+pro/3d+digitizer/ppr0579517-125-26-29 Average 90 stars, based on 1 article reviews
3d digitizer - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
GOM Metrology
topometric 3d-sensor atos Topometric 3d Sensor Atos, supplied by GOM Metrology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/3d+data+processing+software+gom+inspect+pro/topometric+3d+sensor+atos/10__3390_slash_jmmp4030068-868-27-30 Average 90 stars, based on 1 article reviews
topometric 3d-sensor atos - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
GOM Metrology
a high-resolution 3d model A High Resolution 3d Model, supplied by GOM Metrology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/3d+data+processing+software+gom+inspect+pro/a+high+resolution+3d+model/pmc10355447-81-1-7 Average 90 stars, based on 1 article reviews
a high-resolution 3d model - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
GOM Metrology
the atos core 135 model The Atos Core 135 Model, supplied by GOM Metrology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/3d+data+processing+software+gom+inspect+pro/the+atos+core+135+model/10__1016_slash_j__ees__2024__07__004-113-23-34 Average 90 stars, based on 1 article reviews
the atos core 135 model - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
GOM Inc
3d digitizing instruments 3d Digitizing Instruments, supplied by GOM Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/3d+data+processing+software+gom+inspect+pro/3d+digitizing+instruments/pm36079520-81-1-6 Average 90 stars, based on 1 article reviews
3d digitizing instruments - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
GOM Metrology
aramis 3d 5m system Aramis 3d 5m System, supplied by GOM Metrology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/3d+data+processing+software+gom+inspect+pro/aramis+3d+5m+system/pmc11123082-50-20-24 Average 90 stars, based on 1 article reviews
aramis 3d 5m system - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
GOM Metrology
aramis adjustable 3d camera Aramis Adjustable 3d Camera, supplied by GOM Metrology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/3d+data+processing+software+gom+inspect+pro/aramis+adjustable+3d+camera/pmc11505458-51-41-45 Average 90 stars, based on 1 article reviews
aramis adjustable 3d camera - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
ARTEC CO LTD
3d digitizer mh 3d Digitizer Mh, supplied by ARTEC CO LTD, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/3d+data+processing+software+gom+inspect+pro/3d+digitizer+mh/pmc06608300-194-13-16 Average 90 stars, based on 1 article reviews
3d digitizer mh - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
Dalsa corp
4m gom aramis 3d (stereo) digital image correlation system 4m Gom Aramis 3d (Stereo) Digital Image Correlation System, supplied by Dalsa corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/3d+data+processing+software+gom+inspect+pro/4m+gom+aramis+3d++stereo++digital+image+correlation+system/10__1016_slash_j__compstruct__2018__05__048-92-1-18 Average 90 stars, based on 1 article reviews
4m gom aramis 3d (stereo) digital image correlation system - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
90
|
GOM Inc
stereo-dic (surface 3d) system Stereo Dic (Surface 3d) System, supplied by GOM Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/3d+data+processing+software+gom+inspect+pro/stereo+dic++surface+3d++system/10__1016_slash_j__ijmecsci__2022__107663-86-7-11 Average 90 stars, based on 1 article reviews
stereo-dic (surface 3d) system - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
N/A
|
MicroRNA: hsa-miR-518d-3p Accession Number: MIMAT0002864 Mature Sequence: CAAAGCGCUUCCCUUUGGAGC hsa-miR-518d-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation,
|
Buy from Supplier |
N/A
|
MicroRNA: mmu-miR-466d-3p Accession Number: MIMAT0004931 Mature Sequence: UAUACAUACACGCACACAUAG mmu-miR-466d-3p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation,
|
Buy from Supplier |